mosquito crystal pipetting robot platform (SPT Labtech)
SPT Labtech is a verified supplier 
SPT Labtech manufactures this product 
96
Structured Review
SPT Labtech
mosquito crystal pipetting robot platform
Mosquito Crystal Pipetting Robot Platform, supplied by SPT Labtech, used in various techniques. Bioz Stars score: 96/100, based on 696 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mosquito+crystal+pipetting+robot/mosquito+crystal/us11225481-253-28-33
Average 96 stars, based on 696 article reviews
Mosquito Crystal Pipetting Robot Platform, supplied by SPT Labtech, used in various techniques. Bioz Stars score: 96/100, based on 696 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mosquito+crystal+pipetting+robot/mosquito+crystal/us11225481-253-28-33
Average 96 stars, based on 696 article reviews
mosquito crystal pipetting robot platform - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Crystallization Assay:Article Title: Crystallization and crystallographic analysis of an Arabidopsis nuclear proteinaceous RNase P Article Snippet: Lane L , molecular-weight ladder (labelled in kDa); lanes 6–11, fractions from SEC. Fractions 9 and 10 were pooled to perform crystallization assays. ( c ) Monodisperse population of a pure ultracentrifuged PRORP2 sample observed by DLS in the crystallization buffer containing 5%( w / v ) glycerol. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Source organism A. thaliana DNA source At2g16650 Forward primer CACGGTCAATGGCAAGGTAT Reverse primer TGAAAATGTTGCTGGCTGAGA Expression vector pET-28b(+), Novagen Expression system E. coli BL21 (DE3) Complete amino-acid sequence of the PRORP2 construct MGAASDQHRSRRHDESSSRPNKKKKVSRNPETNLLFNLNSCSKSKDLSAALALYDAAITSSEVRLSQQHFQTLLYLCSASITDISLQYLAIDRGFEIFDRMVSSGISPNEASVTSVARLAAAKGNGDYAFKVVKEFVSVGGVSIPRLRTYAPALLCFCEKLEAEKGYEVEEHMEAAGIALEEAEISALLKVSAATGRENKVYRYLHKLREYVGCVSEETLKIIEEWFCGEKAGEVGDNGIGSDVGMLREAVLNNGGGWHGHGWVGEGKWTVKKGNVSSTGRCLSCSEQLACVDTNEVETQKFVDSLVALAMDRKTKMNSCETNVVFSEFQDWLEKHGDYEAIVDGANIGLYQQNFVDGSFSLSQLESVMKELYRESGNNKWPLILLHKRRVKTLLENPTHRNLVEEWISNGVLYATPPGSNDDWYWLYAAAKLKCLLVTNDEMRDHIFELLGSTFFQKWKERHQVRYTFVKGNLKLEMPSPFSVVIQESEKGSWHFPVSCENNEESSRTWMCISRQSILDSPKSNGKIPLEHHHHHH Open in a separate window caption a8 Macromolecule-production information 2.2. .. Crystallization The search for crystallization conditions was carried out by vapour diffusion using a Article Title: Crystallization and crystallographic analysis of an Arabidopsis nuclear proteinaceous RNase P Article Snippet: Lane L , molecular-weight ladder (labelled in kDa); lanes 6–11, fractions from SEC. Fractions 9 and 10 were pooled to perform crystallization assays. ( c ) Monodisperse population of a pure ultracentrifuged PRORP2 sample observed by DLS in the crystallization buffer containing 5%( w / v ) glycerol. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Source organism A. thaliana DNA source At2g16650 Forward primer CACGGTCAATGGCAAGGTAT Reverse primer TGAAAATGTTGCTGGCTGAGA Expression vector pET-28b(+), Novagen Expression system E. coli BL21 (DE3) Complete amino-acid sequence of the PRORP2 construct MGAASDQHRSRRHDESSSRPNKKKKVSRNPETNLLFNLNSCSKSKDLSAALALYDAAITSSEVRLSQQHFQTLLYLCSASITDISLQYLAIDRGFEIFDRMVSSGISPNEASVTSVARLAAAKGNGDYAFKVVKEFVSVGGVSIPRLRTYAPALLCFCEKLEAEKGYEVEEHMEAAGIALEEAEISALLKVSAATGRENKVYRYLHKLREYVGCVSEETLKIIEEWFCGEKAGEVGDNGIGSDVGMLREAVLNNGGGWHGHGWVGEGKWTVKKGNVSSTGRCLSCSEQLACVDTNEVETQKFVDSLVALAMDRKTKMNSCETNVVFSEFQDWLEKHGDYEAIVDGANIGLYQQNFVDGSFSLSQLESVMKELYRESGNNKWPLILLHKRRVKTLLENPTHRNLVEEWISNGVLYATPPGSNDDWYWLYAAAKLKCLLVTNDEMRDHIFELLGSTFFQKWKERHQVRYTFVKGNLKLEMPSPFSVVIQESEKGSWHFPVSCENNEESSRTWMCISRQSILDSPKSNGKIPLEHHHHHH Open in a separate window caption a8 Macromolecule-production information .. The search for crystallization conditions was carried out by vapour diffusion using a Diffusion-based Assay:Article Title: Crystallization and crystallographic analysis of an Arabidopsis nuclear proteinaceous RNase P Article Snippet: Lane L , molecular-weight ladder (labelled in kDa); lanes 6–11, fractions from SEC. Fractions 9 and 10 were pooled to perform crystallization assays. ( c ) Monodisperse population of a pure ultracentrifuged PRORP2 sample observed by DLS in the crystallization buffer containing 5%( w / v ) glycerol. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Source organism A. thaliana DNA source At2g16650 Forward primer CACGGTCAATGGCAAGGTAT Reverse primer TGAAAATGTTGCTGGCTGAGA Expression vector pET-28b(+), Novagen Expression system E. coli BL21 (DE3) Complete amino-acid sequence of the PRORP2 construct MGAASDQHRSRRHDESSSRPNKKKKVSRNPETNLLFNLNSCSKSKDLSAALALYDAAITSSEVRLSQQHFQTLLYLCSASITDISLQYLAIDRGFEIFDRMVSSGISPNEASVTSVARLAAAKGNGDYAFKVVKEFVSVGGVSIPRLRTYAPALLCFCEKLEAEKGYEVEEHMEAAGIALEEAEISALLKVSAATGRENKVYRYLHKLREYVGCVSEETLKIIEEWFCGEKAGEVGDNGIGSDVGMLREAVLNNGGGWHGHGWVGEGKWTVKKGNVSSTGRCLSCSEQLACVDTNEVETQKFVDSLVALAMDRKTKMNSCETNVVFSEFQDWLEKHGDYEAIVDGANIGLYQQNFVDGSFSLSQLESVMKELYRESGNNKWPLILLHKRRVKTLLENPTHRNLVEEWISNGVLYATPPGSNDDWYWLYAAAKLKCLLVTNDEMRDHIFELLGSTFFQKWKERHQVRYTFVKGNLKLEMPSPFSVVIQESEKGSWHFPVSCENNEESSRTWMCISRQSILDSPKSNGKIPLEHHHHHH Open in a separate window caption a8 Macromolecule-production information 2.2. .. Crystallization The search for crystallization conditions was carried out by vapour diffusion using a Article Title: Crystallization and crystallographic analysis of an Arabidopsis nuclear proteinaceous RNase P Article Snippet: Lane L , molecular-weight ladder (labelled in kDa); lanes 6–11, fractions from SEC. Fractions 9 and 10 were pooled to perform crystallization assays. ( c ) Monodisperse population of a pure ultracentrifuged PRORP2 sample observed by DLS in the crystallization buffer containing 5%( w / v ) glycerol. table ft1 table-wrap mode="anchored" t5 Table 1 caption a7 Source organism A. thaliana DNA source At2g16650 Forward primer CACGGTCAATGGCAAGGTAT Reverse primer TGAAAATGTTGCTGGCTGAGA Expression vector pET-28b(+), Novagen Expression system E. coli BL21 (DE3) Complete amino-acid sequence of the PRORP2 construct MGAASDQHRSRRHDESSSRPNKKKKVSRNPETNLLFNLNSCSKSKDLSAALALYDAAITSSEVRLSQQHFQTLLYLCSASITDISLQYLAIDRGFEIFDRMVSSGISPNEASVTSVARLAAAKGNGDYAFKVVKEFVSVGGVSIPRLRTYAPALLCFCEKLEAEKGYEVEEHMEAAGIALEEAEISALLKVSAATGRENKVYRYLHKLREYVGCVSEETLKIIEEWFCGEKAGEVGDNGIGSDVGMLREAVLNNGGGWHGHGWVGEGKWTVKKGNVSSTGRCLSCSEQLACVDTNEVETQKFVDSLVALAMDRKTKMNSCETNVVFSEFQDWLEKHGDYEAIVDGANIGLYQQNFVDGSFSLSQLESVMKELYRESGNNKWPLILLHKRRVKTLLENPTHRNLVEEWISNGVLYATPPGSNDDWYWLYAAAKLKCLLVTNDEMRDHIFELLGSTFFQKWKERHQVRYTFVKGNLKLEMPSPFSVVIQESEKGSWHFPVSCENNEESSRTWMCISRQSILDSPKSNGKIPLEHHHHHH Open in a separate window caption a8 Macromolecule-production information .. The search for crystallization conditions was carried out by vapour diffusion using a Article Title: Combining crystallogenesis methods to produce diffraction-quality crystals of a psychrophilic tRNA-maturation enzyme Article Snippet: Initial screening by vapor diffusion All experiments were performed at 293 K. Prior to crystallization assays, Pha CCA was ultracentrifuged at 105 000 g and 277 K for 1 h in a Sorvall Discovery M150 SE ultracentrifuge (Hitachi). .. Initial screens, microseed matrix screening and further optimizations were carried out by vapor diffusion using a Article Title: Combining crystallogenesis methods to produce diffraction-quality crystals of a psychrophilic tRNA-maturation enzyme Article Snippet: All experiments were performed at 293 K. Prior to crystallization assays, PhaCCA was ultracentrifuged at 105 000g and 277 K for 1 h in a Sorvall Discovery M150 SE ultracentrifuge (Hitachi). .. Initial screens, microseed matrix screening and further optimizations were carried out by vapor diffusion using a |